How may STRs?

Activity 8: Proving Your Innocence!

You have been accused of committing murder …

A 1:54am on March 10, 2019 police officers responded to a call that resulted in the discovery of one deceased male. Two witnesses identified you and your parent as suspicious individuals and you both have been charged with the murder. The police have collected DNA evidence from the crime scene and from both of you, and they claim that they have DNA proof that you are murderer! You maintain your innocence and will do everything that you can to bring the true criminal to justice.

Below are nucleotide sequences from your and your parent’s DNA at four STR sites. Determine the number of STRs (short tandem repeats) in the chromosomes for both of you. Look for the sequence “GATA”, and if it is repeated, then count and note the number of repeats. Those numbers have been filled in for you, but you will need to find repeats later on.

YOUR CHROMOSOMES:

STR Site 1:

TCTTATGGCAAAACCGATGGACTGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAATGTTTCGGGTAGCACCAGGAGTCTGTAGCACGTGCATCTCAACGTGGCGTGCGTACACGGTACG How may STRs? 11

STR Site 2:

CTCGGCGTTGTGTGTCAAATGGCGTAGATCTGGATTGACTCTATGACGGTATCTGCTGATCGGTAGGGAGACCGAGAATCTATGATAGATAGATAGATAGATAGATACAACTTTCCAAACACCCCGTGTCGTC How may STRs? 6

STR Site 3:

GATTACCTCGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAAAGGATGAGTGTCAGCCA

How may STRs? 27

STR Site 4:

CTATTGTACTAATCGGCTTCAACGAGCCGTACAGGTGGCACCTCAGGAGGGGCCCGCAGGGAGGAAGTAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAAACT How may STRs? 15

YOUR PARENT’S CHROMOSOMES:

STR Site 1:

GCCGTGTAATGATAGATAGATAGATAGATAGATAGATAGATAGATAACAACCACACCTTAGCGAATTGATGCGCCGCTTCGGAATACCGTTTTGGCTACCCGTTACTAAGCCCATCGCGATTTTCAGGTATCGT

How may STRs? 9

STR Site 2:

CTCGGCGTTGTGTGTCAAATGGCGTAGATCTGGATTGACTCTATGACGGTATCTGCTGATCGGTAGGGAGACCGAGAATCTATGATAGATAGATAGATAGATAGATACAACTTTCCAAACACCCCGTGTCGTC How may STRs? 6

STR Site 3:

GATTACCTCGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAAAGGATGAGTGTCAGCCA

How may STRs? 27

STR Site 4:

CCGGAATCAGTGACTTTGACAGGTTTGTGGGGTACAGCAATGAGATAGATAGATACTTGCATAGCTGCGTATGGAGGAAGGAACTCTTGCGTGTTAGTATGTTGACCCCTGTATTACGGATGCGGGTAGAAGA

How may STRs? 3

1. Using the values given above, fill in the following table:

STR Site 1 STR Site 2 STR Site 3 STR Site 4
You
Your Parent

2. After identifying the STRs in the chromosomes, the police forensic team will need to make copies of the repeated regions in order to use for further DNA analysis. What is the method called in which you “amplify” or replicate DNA in a test tube?

3. After the DNA has been amplified, the forensic team uses gel electrophoresis in order to compare DNA samples. In the gel below, you will find that the crime scene DNA has already been analyzed and plotted along the left side of the gel. Using the numbers of STRs that you determined above, mark the positions of each STR in the gel for you and your parent. (Leave the right two columns blank – you will fill them in later.)

4. Based on the gel electrophoresis analysis above, were the police correct that you are in fact the murderer? Why or why not?

You maintain your innocence, and through good old-fashioned detective work you are able to identify two additional suspects who were recently arrested breaking into a nearby Circle-K: Theodore Logan and William S. Preston, Esquire. You are able to isolate their DNA from saliva on soda straws.

5. Determine the numbers of STRs at sites 3 &4 for William and Theodore. Note that the numbers of STRs have already been found for their first two sites. Again, look for the repeated sequence of “GATA”. (Hint: use the “Find”/ “Search” function to locate sequence easily.)

WILLIAM’S CHROMOSOMES:

STR Site 1:

CGCTTATGGTCCATAGCACATTCATCGCATCCGGGCGTGCTCTATTTGACGATCCCTGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATACC How may STRs? 19

STR Site 2:

CACTCTATTGAGGCATTAACGATAGATAGATAGATAGATAGATAGGAAGGAGATCTGGAATGAACTGGCCTATGTCACAGAAACTGTGCAAATACCCAATGTCGTTAGTGTAGGTTCTGACCCGCACTCTATTG

How may STRs? 6

STR Site 3:

TTTACAACTGGGGACATAAACCCTACGCCCATCATCTACTGACGTCCCTGAGGCTGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATACCAGTTCATGTAATGGGAGAGTATCCGCCGCAAGA

How may STRs?

STR Site 4:

GCGACACGGGTAGGATCATCAGTAATAAGAGTAGTGGGAAAGCTCACAGACCACCGCCTATAGGGGGTGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAAGCG

How may STRs?

THEODORE’S CHROMOSOMES:

STR Site 1:

CGGTCGATCCGGAGGGACGGGCCTCAAAGCCGCGTCACGACCGGAGTAAGCTCCCGTGGGCCTGGATAGATAGATAGATAGATAGATAGATAGATAGAACAGCCCTGGTGGGCCCCATCAGCAGCCCGAA

How may STRs? 8

STR Site 2:

CGCTTTTCGGGACGCGGGCCGAGGGGCGATGCCTTCCACTAATCGAGGCCGTTCGTTAATACTTGGATAGATAGATAGATAGATAGATATTGCGTTCCTAGCGCCTATATTTGTCTCTTTGCCGGCTTATGTG

How may STRs? 6

STR Site 3:

TCGGAGCGCGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATACTCGGTACACGGTATGAGCAGGCGC How may STRs?

STR Site 4:

ATTTAATCTGGCTGAGGTGTAGACGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAATTCCAGGCGGTGCGTCTGCTGTCGGGTCCCTCTGGTGACTGGCTAGATGGACTTGCC

How may STRs?

6. Using the values given above, fill in the following table:

STR Site 1 STR Site 2 STR Site 3 STR Site 4
William
Theodore

7. Plot the results of your DNA profiles for William and Theodore in the two right columns on the gel in Question 3. Are either of them a match for the DNA at the crime scene, and if so, who?

8. Why do you think that it is important to consider multiple STR sites when constructing a DNA profile? (Think about what would happen if the police only looked at STR Site 2.)

25 nucleotides

Crime Scene DNA

Your DNA

Parnent’s DNA

20 nucleotides

15 nucleotides

10 nucleotides

5 nucleotides

“Get 15% discount on your first 3 orders with us”
Use the following coupon
FIRST15

Order Now